Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 4106420
End position: 4106443
Length: 24

DNA sequence
>NC_009665, from 4106420 to 4106443 (24 bp); Shewanella baltica OS185 CAATTTCAGTTTCAAATTCAGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4106230-4107138	Sequence	Shew185_3459 - hypothetical protein (Protein is coded in complementary strand; from 4107138 to 4106230)