Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 4008965
End position: 4009003
Length: 39

DNA sequence
>NC_009665, from 4008965 to 4009003 (39 bp); Shewanella baltica OS185 ATTTCAACAACTCATTTCAACAAGTCATTTCAACAACTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4008990-4009325	Sequence	Shew185_3368 - hypothetical protein (Protein is coded in complementary strand; from 4009325 to 4008990)