Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 3960818
End position: 3960862
Length: 45

DNA sequence
>NC_009665, from 3960818 to 3960862 (45 bp); Shewanella baltica OS185 AACTGATATTAGAACGACTAATATTAGAACTACTAATGTTAGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3959554-3960867	Sequence	Shew185_3328 - hypothetical protein (Protein is coded in complementary strand; from 3960867 to 3959554)
ORF... 3960857-3963019	Sequence	Shew185_3329 - TonB-dependent siderophore receptor (Protein is coded in complementary strand; from 3963019 to 3960857)