Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 3934610
End position: 3934654
Length: 45

DNA sequence
>NC_009665, from 3934610 to 3934654 (45 bp); Shewanella baltica OS185 AGCGTCTTCAACATGAGTGCCTTTAACATGAGTGCCTTTAACATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3933441-3934748	Sequence	Shew185_3301 - UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase (Protein is coded in complementary strand; from 3934748 to 3933441)