Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 3893946
End position: 3893984
Length: 39

DNA sequence
>NC_009665, from 3893946 to 3893984 (39 bp); Shewanella baltica OS185 TCATTCCAACAAGTCGTTTCAACAAGTCATTTCAACAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3893973-3894299	Sequence	Shew185_3259 - hypothetical protein (Protein is coded in complementary strand; from 3894299 to 3893973)