Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 3708323
End position: 3708347
Length: 25

DNA sequence
>NC_009665, from 3708323 to 3708347 (25 bp); Shewanella baltica OS185 CATTTGATTTCCTTTCAATTGATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3706548-3708326	Sequence	Shew185_3109 - hypothetical protein (Protein is coded in complementary strand; from 3708326 to 3706548)