Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 3205413
End position: 3205448
Length: 36

DNA sequence
>NC_009665, from 3205413 to 3205448 (36 bp); Shewanella baltica OS185 AGCTCTGGTTTAAGCCCTTGTTTAAGTTCTGCTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3204708-3205778	Sequence	Shew185_2680 - cell division protein ZipA (Protein is coded in complementary strand; from 3205778 to 3204708)