Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 2766013
End position: 2766039
Length: 27

DNA sequence
>NC_009665, from 2766013 to 2766039 (27 bp); Shewanella baltica OS185 ATTTCCAGAATTTCCAGAATTTCCAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2764565-2767009	Sequence	Shew185_2316 - protein-glutamate O-methyltransferase (Protein is coded in complementary strand; from 2767009 to 2764565)