Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 2690022
End position: 2690057
Length: 36

DNA sequence
>NC_009665, from 2690022 to 2690057 (36 bp); Shewanella baltica OS185 TGCTCATGCTCATGCTCATGCTCATGCTCATGCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2689548-2690813	Sequence	Shew185_2257 - cation diffusion facilitator family transporter (Protein is coded in complementary strand; from 2690813 to 2689548)