Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 2473967
End position: 2473993
Length: 27

DNA sequence
>NC_009665, from 2473967 to 2473993 (27 bp); Shewanella baltica OS185 TCATTAACGTCATTAACGTCATTAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2473373-2476030	Sequence	Shew185_2063 - electron transport complex protein RnfC (Protein is coded in complementary strand; from 2476030 to 2473373)