Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 2413868
End position: 2413894
Length: 27

DNA sequence
>NC_009665, from 2413868 to 2413894 (27 bp); Shewanella baltica OS185 ATCTTGTTCATCTTGTTTATCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2413497-2413940	Sequence	Shew185_2022 - methylated-DNA--protein-cysteine methyltransferase (Protein is coded in complementary strand; from 2413940 to 2413497)