Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 2224552
End position: 2224611
Length: 60

DNA sequence
>NC_009665, from 2224552 to 2224611 (60 bp); Shewanella baltica OS185 CCTGAGGTTGTGCCTGAGGTTGTGCCTGAGGTTGTGCCTGAGGTTGTGCCTGAGGTTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2223924-2225264	Sequence	Shew185_1866 - hypothetical protein (Protein is coded in complementary strand; from 2225264 to 2223924)