Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 2109200
End position: 2109244
Length: 45

DNA sequence
>NC_009665, from 2109200 to 2109244 (45 bp); Shewanella baltica OS185 AGCTCTGACCTTGCAAACTTTTACCTTGCAAACTCTGACCTTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2108245-2109627	Sequence	Shew185_1750 - adenosylmethionine-8-amino-7-oxononanoate aminotransferase (Protein is coded in complementary strand; from 2109627 to 2108245)