Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 2022726
End position: 2022770
Length: 45

DNA sequence
>NC_009665, from 2022726 to 2022770 (45 bp); Shewanella baltica OS185 TCTATCGACTTAGCATCTGCCGGCTTAGCATCGATGGAATTAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2020521-2023985	Sequence	Shew185_1674 - hypothetical protein (Protein is coded in complementary strand; from 2023985 to 2020521)