Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 1782795
End position: 1782848
Length: 54

DNA sequence
>NC_009665, from 1782795 to 1782848 (54 bp); Shewanella baltica OS185 GGGGTTCCGGGTGTACCTGGTGTTCCGGGAGTGCCTGGTGTTCCGGGTGTGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1780665-1782950	Sequence	Shew185_1473 - decaheme cytochrome c (Protein is coded in complementary strand; from 1782950 to 1780665)