Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 1542605
End position: 1542649
Length: 45

DNA sequence
>NC_009665, from 1542605 to 1542649 (45 bp); Shewanella baltica OS185 AAAGCCACTCCATCAACAGCCACGCCATCAAAAGCGACGACATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1542345-1545110	Sequence	Shew185_1295 - PAS/PAC and GAF sensor(s)-containing diguanylate cyclase/phosphodiesterase