Sequence retrieval

Genome: Shewanella baltica OS185
Start position: 1210854
End position: 1210883
Length: 30

DNA sequence
>NC_009665, from 1210854 to 1210883 (30 bp); Shewanella baltica OS185 TGCTTGATATTGATTGCTATCGATTGATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1210777-1211532	Sequence	Shew185_1019 - MotA/TolQ/ExbB proton channel (Protein is coded in complementary strand; from 1211532 to 1210777)