Sequence retrieval

Genome: Thermosipho melanesiensis BI429
Start position: 803842
End position: 803868
Length: 27

DNA sequence
>NC_009616, from 803842 to 803868 (27 bp); Thermosipho melanesiensis BI429 TATAGCTTCTATAGCTTCTATATCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 803339-804370	Sequence	Tmel_0761 - mandelate racemase/muconate lactonizing protein (Protein is coded in complementary strand; from 804370 to 803339)