Sequence retrieval

Genome: Thermosipho melanesiensis BI429
Start position: 203167
End position: 203190
Length: 24

DNA sequence
>NC_009616, from 203167 to 203190 (24 bp); Thermosipho melanesiensis BI429 AAAAGAAAAGGAAATAGAAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 202689-204029	Sequence	Tmel_0195 - DNA mismatch repair protein MutS domain-containing protein