Sequence retrieval

Genome: Thermosipho melanesiensis BI429
Start position: 1911402
End position: 1911431
Length: 30

DNA sequence
>NC_009616, from 1911402 to 1911431 (30 bp); Thermosipho melanesiensis BI429 TTTTTCAAGATTTTTTTAGATTCTTCAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1910913-1911596	Sequence	Tmel_1925 - 4-diphosphocytidyl-2C-methyl-D-erythritol synthase (Protein is coded in complementary strand; from 1911596 to 1910913)