Sequence retrieval

Genome: Thermosipho melanesiensis BI429
Start position: 1840706
End position: 1840729
Length: 24

DNA sequence
>NC_009616, from 1840706 to 1840729 (24 bp); Thermosipho melanesiensis BI429 AAAAAGAAAATGTAAAAGAAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1839275-1841980	Sequence	Tmel_1855 - DEAD/DEAH box helicase domain-containing protein