Sequence retrieval

Genome: Thermosipho melanesiensis BI429
Start position: 1627763
End position: 1627792
Length: 30

DNA sequence
>NC_009616, from 1627763 to 1627792 (30 bp); Thermosipho melanesiensis BI429 TCTTTTTTTGTCTTTTCTTTTCTTGATTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1627739-1628194	Sequence	Tmel_1639 - hypothetical protein (Protein is coded in complementary strand; from 1628194 to 1627739)