Sequence retrieval

Genome: Thermosipho melanesiensis BI429
Start position: 1463440
End position: 1463487
Length: 48

DNA sequence
>NC_009616, from 1463440 to 1463487 (48 bp); Thermosipho melanesiensis BI429 CACTACGGTTTTCACTTCGATTTTCACTTCGGTTTTCACTACTGTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1462989-1463819	Sequence	Tmel_1471 - CRP/FNR family transcriptional regulator (Protein is coded in complementary strand; from 1463819 to 1462989)