Sequence retrieval

Genome: Thermosipho melanesiensis BI429
Start position: 143149
End position: 143178
Length: 30

DNA sequence
>NC_009616, from 143149 to 143178 (30 bp); Thermosipho melanesiensis BI429 CACATTTTTTCAAATTCTTTTACCTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 143050-143499	Sequence	Tmel_0135 - MarR family transcriptional regulator (Protein is coded in complementary strand; from 143499 to 143050)