Sequence retrieval

Genome: Thermosipho melanesiensis BI429
Start position: 1316319
End position: 1316348
Length: 30

DNA sequence
>NC_009616, from 1316319 to 1316348 (30 bp); Thermosipho melanesiensis BI429 TTTTTTTATTTTGTTCTTTTCTTTTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1316008-1317186	Sequence	Tmel_1306 - phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase (Protein is coded in complementary strand; from 1317186 to 1316008)