Sequence retrieval

Genome: Thermosipho melanesiensis BI429
Start position: 1220385
End position: 1220414
Length: 30

DNA sequence
>NC_009616, from 1220385 to 1220414 (30 bp); Thermosipho melanesiensis BI429 ATGATTTTTCATGATTTTCCATTCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1220038-1221699	Sequence	Tmel_1204 - metal dependent phosphohydrolase (Protein is coded in complementary strand; from 1221699 to 1220038)