Sequence retrieval

Genome: Haemophilus influenzae PittGG
Start position: 590321
End position: 590356
Length: 36

DNA sequence
>NC_009567, from 590321 to 590356 (36 bp); Haemophilus influenzae PittGG AAACATGATCATAAACACGACCATGACCATGATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 589929-591032	Sequence	CGSHiGG_03175 znuA high-affinity zinc transporter periplasmic component