Sequence retrieval

Genome: Haemophilus influenzae PittGG
Start position: 361335
End position: 361358
Length: 24

DNA sequence
>NC_009567, from 361335 to 361358 (24 bp); Haemophilus influenzae PittGG TCTATATCTATTTCAATATCTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 361227-361499	Sequence	CGSHiGG_02025 - hypothetical protein (Protein is coded in complementary strand; from 361499 to 361227)