Sequence retrieval

Genome: Haemophilus influenzae PittGG
Start position: 316843
End position: 316878
Length: 36

DNA sequence
>NC_009567, from 316843 to 316878 (36 bp); Haemophilus influenzae PittGG CACCGAAAATATCGCCAAAAATATCGCCGAACATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 316011-317159	Sequence	CGSHiGG_01820 - chaperone protein DnaJ (Protein is coded in complementary strand; from 317159 to 316011)