Sequence retrieval

Genome: Haemophilus influenzae PittGG
Start position: 277511
End position: 277555
Length: 45

DNA sequence
>NC_009567, from 277511 to 277555 (45 bp); Haemophilus influenzae PittGG TTGTTTTTCTACCGCACTTTTTTCTACCGCACTTTTTTCTACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 277368-278099	Sequence	CGSHiGG_01615 - hydroxyacylglutathione hydrolase (Protein is coded in complementary strand; from 278099 to 277368)