Sequence retrieval

Genome: Haemophilus influenzae PittGG
Start position: 199850
End position: 199897
Length: 48

DNA sequence
>NC_009567, from 199850 to 199897 (48 bp); Haemophilus influenzae PittGG GCATTGCTTGCTTGCTTGCTTGCTTGCTTGCTTGCTTGCTTGCTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 199816-199923	Sequence	CGSHiGG_01180 - hypothetical protein (Protein is coded in complementary strand; from 199923 to 199816)