Sequence retrieval

Genome: Haemophilus influenzae PittGG
Start position: 1589726
End position: 1589761
Length: 36

DNA sequence
>NC_009567, from 1589726 to 1589761 (36 bp); Haemophilus influenzae PittGG TGTATTGGTTGTTGTACTGGCTGTTGCATTGGTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1589382-1590818	Sequence	CGSHiGG_08580 - transferrin-binding protein 2 (Protein is coded in complementary strand; from 1590818 to 1589382)