Sequence retrieval

Genome: Haemophilus influenzae PittGG
Start position: 116446
End position: 116475
Length: 30

DNA sequence
>NC_009567, from 116446 to 116475 (30 bp); Haemophilus influenzae PittGG ATAATTGTCTATAATTAACTTTAATTGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 116339-116800	Sequence	CGSHiGG_00600 - hypothetical protein (Protein is coded in complementary strand; from 116800 to 116339)