Sequence retrieval

Genome: Haemophilus influenzae PittGG
Start position: 1005234
End position: 1005257
Length: 24

DNA sequence
>NC_009567, from 1005234 to 1005257 (24 bp); Haemophilus influenzae PittGG TAAAATCAAAATTAAAAGTAAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1004236-1005279	Sequence	CGSHiGG_05525 - periplasmic solute-binding protein (Protein is coded in complementary strand; from 1005279 to 1004236)