Sequence retrieval

Genome: Synechococcus sp. WH 7803
Start position: 1898892
End position: 1898915
Length: 24

DNA sequence
>NC_009481, from 1898892 to 1898915 (24 bp); Synechococcus sp. WH 7803 CCATGTCCATGTCCATGTCCATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1898360-1900210	Sequence	SynWH7803_2069 - carbohydrate-binding protein (Protein is coded in complementary strand; from 1900210 to 1898360)