Sequence retrieval

Genome: Synechococcus sp. WH 7803
Start position: 281830
End position: 281874
Length: 45

DNA sequence
>NC_009481, from 281830 to 281874 (45 bp); Synechococcus sp. WH 7803 TCGTCATCGTTGCTGTCGTCGTCTTCGCTGTCGTTGTCGTCGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 280903-283089	Sequence	SynWH7803_0258 chlD protoporphyrin IX Mg-chelatase subunit ChlD (Protein is coded in complementary strand; from 283089 to 280903)