Sequence retrieval

Genome: Synechococcus sp. WH 7803
Start position: 1723742
End position: 1723786
Length: 45

DNA sequence
>NC_009481, from 1723742 to 1723786 (45 bp); Synechococcus sp. WH 7803 TTTCGCCGCTGGTTTTTTGGCGGCAGGTTTCTTCGCCGCCGGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1723656-1726373	Sequence	SynWH7803_1883 topA DNA topoisomerase I (Protein is coded in complementary strand; from 1726373 to 1723656)