Sequence retrieval

Genome: Synechococcus sp. WH 7803
Start position: 439539
End position: 439574
Length: 36

DNA sequence
>NC_009481, from 439539 to 439574 (36 bp); Synechococcus sp. WH 7803 GCGGCGGTCACCGCGACGGCCACCGCGACGGTCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 439045-439692	Sequence	SynWH7803_0418 rpsE 30S ribosomal protein S5 (Protein is coded in complementary strand; from 439692 to 439045)