Sequence retrieval

Genome: Synechococcus sp. WH 7803
Start position: 413500
End position: 413535
Length: 36

DNA sequence
>NC_009481, from 413500 to 413535 (36 bp); Synechococcus sp. WH 7803 GGTTCAGTGGCTGGTTCTGTGGCTGGTTCTGTGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 413176-414510	Sequence	SynWH7803_0389 - hypothetical protein (Protein is coded in complementary strand; from 414510 to 413176)