Sequence retrieval

Genome: Synechococcus sp. WH 7803
Start position: 360600
End position: 360635
Length: 36

DNA sequence
>NC_009481, from 360600 to 360635 (36 bp); Synechococcus sp. WH 7803 TCACTGCTTCGCTCACGGCCTCGCTCACTGCTTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 360518-361132	Sequence	SynWH7803_0336 - hypothetical protein (Protein is coded in complementary strand; from 361132 to 360518)