Sequence retrieval

Genome: Synechococcus sp. WH 7803
Start position: 68914
End position: 68937
Length: 24

DNA sequence
>NC_009481, from 68914 to 68937 (24 bp); Synechococcus sp. WH 7803 AGCAGCTGCAGCAGCAGGAGCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 68830-70071	Sequence	SynWH7803_0068 - hypothetical protein (Protein is coded in complementary strand; from 70071 to 68830)