Sequence retrieval

Genome: Synechococcus sp. WH 7803
Start position: 61394
End position: 61417
Length: 24

DNA sequence
>NC_009481, from 61394 to 61417 (24 bp); Synechococcus sp. WH 7803 CGGTGGCGGTGTCGATGGCGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 61131-62996	Sequence	SynWH7803_0062 dnaX DNA polymerase III subunit gamma/tau (Protein is coded in complementary strand; from 62996 to 61131)