Sequence retrieval

Genome: Synechococcus sp. WH 7803
Start position: 1808404
End position: 1808427
Length: 24

DNA sequence
>NC_009481, from 1808404 to 1808427 (24 bp); Synechococcus sp. WH 7803 GGTGGTGGCGGTGGCGGTGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1808119-1809531	Sequence	SynWH7803_1975 - sporulation protein (Protein is coded in complementary strand; from 1809531 to 1808119)