Sequence retrieval

Genome: Synechococcus sp. WH 7803
Start position: 1550484
End position: 1550507
Length: 24

DNA sequence
>NC_009481, from 1550484 to 1550507 (24 bp); Synechococcus sp. WH 7803 TCCAGCCCCAGCTCCTGCTGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1549914-1552415	Sequence	SynWH7803_1695 - hypothetical protein (Protein is coded in complementary strand; from 1552415 to 1549914)