Sequence retrieval

Genome: Pelotomaculum thermopropionicum SI
Start position: 74978
End position: 75001
Length: 24

DNA sequence
>NC_009454, from 74978 to 75001 (24 bp); Pelotomaculum thermopropionicum SI AGGACCAGGCCCAGGGCCAGGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 73877-75034	Sequence	PTH_0077 LivK ABC-type branched-chain amino acid transport systems, periplasmic component (Protein is coded in complementary strand; from 75034 to 73877)