Sequence retrieval

Genome: Pelotomaculum thermopropionicum SI
Start position: 411309
End position: 411333
Length: 25

DNA sequence
>NC_009454, from 411309 to 411333 (25 bp); Pelotomaculum thermopropionicum SI GCCGGGCCGGTCCGGGCCAGGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 410986-411717	Sequence	PTH_0426 - hypothetical protein (Protein is coded in complementary strand; from 411717 to 410986)