Sequence retrieval

Genome: Pelotomaculum thermopropionicum SI
Start position: 371982
End position: 372026
Length: 45

DNA sequence
>NC_009454, from 371982 to 372026 (45 bp); Pelotomaculum thermopropionicum SI TGGGTCTTTGTCTTTTGGGTCCTTGTCTTTTGGATCTTTGTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 370957-372438	Sequence	PTH_0388 - hypothetical protein (Protein is coded in complementary strand; from 372438 to 370957)