Sequence retrieval

Genome: Pelotomaculum thermopropionicum SI
Start position: 2733092
End position: 2733115
Length: 24

DNA sequence
>NC_009454, from 2733092 to 2733115 (24 bp); Pelotomaculum thermopropionicum SI GTGGCCGTGACCGTGCCCGTGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2732141-2733220	Sequence	PTH_2629 - PP family ATPase (Protein is coded in complementary strand; from 2733220 to 2732141)
ORF. 2732973-2733977	Sequence	PTH_2630 - hypothetical protein (Protein is coded in complementary strand; from 2733977 to 2732973)
ORF. 2733015-2733287	Sequence	PTH_2628 - hypothetical protein