Sequence retrieval

Genome: Pelotomaculum thermopropionicum SI
Start position: 2712035
End position: 2712070
Length: 36

DNA sequence
>NC_009454, from 2712035 to 2712070 (36 bp); Pelotomaculum thermopropionicum SI CATGCCGCCCATGCCGCCCATGCCGCCCATGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2712030-2713664	Sequence	PTH_2605 groEL chaperonin GroEL (Protein is coded in complementary strand; from 2713664 to 2712030)