Sequence retrieval

Genome: Pelotomaculum thermopropionicum SI
Start position: 2676537
End position: 2676560
Length: 24

DNA sequence
>NC_009454, from 2676537 to 2676560 (24 bp); Pelotomaculum thermopropionicum SI TTCTTTTTCTTGTTCATTTTCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2676100-2677878	Sequence	PTH_2572 - glycosyltransferase (Protein is coded in complementary strand; from 2677878 to 2676100)